p38 mapk Search Results


86
Sangon Biotech tctagcagagcacggatgtgtttg3
Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tctagcagagcacggatgtgtttg3/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc western cell signaling technology
Western Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/western cell signaling technology/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
western cell signaling technology - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc dictyoptera
Dictyoptera, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dictyoptera/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
dictyoptera - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

99
Cell Signaling Technology Inc anti p p38
Anti P P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti p p38/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
anti p p38 - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc anti phospho p38 mapk t180 y182
Anti Phospho P38 Mapk T180 Y182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti phospho p38 mapk t180 y182/product/Cell Signaling Technology Inc
Average 97 stars, based on 1 article reviews
anti phospho p38 mapk t180 y182 - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc phopho p38
Phopho P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phopho p38/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
phopho p38 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc p p38
HOXA7 regulates the <t>p38</t> MAPK/JNK pathway in hBMSCs and MC3T3-E1 cells. (A–B) Phosphorylated and total p38 MAPK and JNK (p-p38/p38, p-JNK/JNK) in hBMSCs and MC3T3-E1 cells with the indicated transfections were evaluated by Western blotting. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
P P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p p38/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
p p38 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
Boster Bio p38 mitogen activated protein kinase mapk antibody
Silencing Rac1 inhibits the activation of <t>P38</t> <t>MAPK</t> signal in vitro . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) were detected by Western blot analysis. GAPDH served as the internal reference. All experiments were repeated 3 times and the results are presented as mean ±SD. *** P<0.001 compared with the negative control group.
P38 Mitogen Activated Protein Kinase Mapk Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p38 mitogen activated protein kinase mapk antibody/product/Boster Bio
Average 93 stars, based on 1 article reviews
p38 mitogen activated protein kinase mapk antibody - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
Aviva Systems antiphospho thr
FIGURE 3. FBS induces the phosphorylation of JNK, <t>p38,</t> and ERK in CHO-K1cells.Serum-starvedCHO-K1cellsweretreatedwith7.5%FBSforthe indicated times. Total and phosphorylated JNK, p38, and ERK were monitored by Western blot.
Antiphospho Thr, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antiphospho thr/product/Aviva Systems
Average 90 stars, based on 1 article reviews
antiphospho thr - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc p38 mapk
FIGURE 6. 4MU exerts no effect on initial TGF-induced signaling. A, light emission by 3TP-LUX, a luciferase reporter plasmid driven by TGF-respon- sive promoter, after 24 h TGF treatment stimulated light emission by 15- fold in primary keratocytes (p 0.001). This reporter activity was not dimin- ished by treatment with 500 M 4MU. 3TP-Lux activity was normalized by co-transfectionwithcontrolplasmidasdescribedunder“MaterialsandMeth- ods.” The error bars show S.D. of quadruplicate analyses. The difference between TGF and TGF4MU was not significant. B, duplicate cultures of primary keratocytes were treated for 1 h with TGF (as in Fig. 2) in the pres- ence or absence of 400 M 4MU. Equal amounts of protein from cell lysates were immunoblotted for phosphorylated <t>p38</t> <t>MAPK</t> (pp38) using the non- phosphorylated p38 as a loading control. Coum, coumarin; 4ME, 4-methyles- culetin; ESC, esculetin; CTRL, control.
P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p38 mapk/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
p38 mapk - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
PhosphoSolutions anti p38 pt180 y182
FIGURE 6. 4MU exerts no effect on initial TGF-induced signaling. A, light emission by 3TP-LUX, a luciferase reporter plasmid driven by TGF-respon- sive promoter, after 24 h TGF treatment stimulated light emission by 15- fold in primary keratocytes (p 0.001). This reporter activity was not dimin- ished by treatment with 500 M 4MU. 3TP-Lux activity was normalized by co-transfectionwithcontrolplasmidasdescribedunder“MaterialsandMeth- ods.” The error bars show S.D. of quadruplicate analyses. The difference between TGF and TGF4MU was not significant. B, duplicate cultures of primary keratocytes were treated for 1 h with TGF (as in Fig. 2) in the pres- ence or absence of 400 M 4MU. Equal amounts of protein from cell lysates were immunoblotted for phosphorylated <t>p38</t> <t>MAPK</t> (pp38) using the non- phosphorylated p38 as a loading control. Coum, coumarin; 4ME, 4-methyles- culetin; ESC, esculetin; CTRL, control.
Anti P38 Pt180 Y182, supplied by PhosphoSolutions, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti p38 pt180 y182/product/PhosphoSolutions
Average 96 stars, based on 1 article reviews
anti p38 pt180 y182 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
Proteintech jnk
KEGG MAPK signaling pathway enrichment plot. (A-a) The top 20 pathways are highly concentrated in core processes such as tumor-related signal transduction, cell proliferation and apoptosis regulation, metabolism, and inflammation/immunity. These include EGFR tyrosine kinase inhibitor resistance, HIF-1, VEGF, IL-17, TNF, JAK-STAT, PI3K-Akt, MAPK, mTOR, AMPK, FoxO, p53, as well as cell cycle, PD-1/PD-L1 immune checkpoint pathways, B-cell receptor signaling, autophagy-autophagy, NOD-like receptor signaling, lipid and atherosclerosis, serotonergic synapse, and Salmonella infection pathways. Pathways with higher fold enrichment and larger bubbles (e.g., PI3K-Akt, MAPK, TNF, HIF-1, p53, Cell Cycle, Autophagy, etc.) indicate a higher concentration of overlapping genes within these pathways and a significantly increased enrichment factor. This suggests that curcumin’s targets in osteosarcoma primarily cluster within key signaling networks regulating cell proliferation/apoptosis, autophagy, energy metabolism reprogramming, inflammation, and the immune microenvironment. (A-b) Mapping results reveal that the intersecting target genes are widely distributed across the MAPK signaling pathway, covering the classical MAPK <t>cascade,</t> <t>JNK/p38</t> branches, and key nodes interacting with the p53 pathway (Figure X). Upstream, molecules such as TNF and other cytokines are highlighted, suggesting that inflammation and stress stimuli are important triggers for activating this pathway. Midstream, multi-tiered kinase cascades (e.g., MAPKKK–MAPKK–MAPK) and stress-responsive MAPK members like JNK and p38 were marked, indicating that intersecting targets primarily participate in amplifying and transducing stress signals. Downstream, transcription factor nodes such as TP53 were also enriched, connecting to effector pathways including cell cycle arrest, apoptosis, and differentiation.
Jnk, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/jnk/product/Proteintech
Average 96 stars, based on 1 article reviews
jnk - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

Image Search Results


HOXA7 regulates the p38 MAPK/JNK pathway in hBMSCs and MC3T3-E1 cells. (A–B) Phosphorylated and total p38 MAPK and JNK (p-p38/p38, p-JNK/JNK) in hBMSCs and MC3T3-E1 cells with the indicated transfections were evaluated by Western blotting. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Journal: Journal of Musculoskeletal & Neuronal Interactions

Article Title: HOXA7 Impairs Osteogenic Differentiation via p38/JNK Signaling: Implications for Osteoporosis

doi: 10.22540/JMNI-26-134

Figure Lengend Snippet: HOXA7 regulates the p38 MAPK/JNK pathway in hBMSCs and MC3T3-E1 cells. (A–B) Phosphorylated and total p38 MAPK and JNK (p-p38/p38, p-JNK/JNK) in hBMSCs and MC3T3-E1 cells with the indicated transfections were evaluated by Western blotting. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Article Snippet: p-p38 , 9216 , 1:1,000 , CST, Danvers, MA, USA.

Techniques: Transfection, Western Blot

Effects of SP600125 and SB203580 on proliferation, apoptosis, and autophagy in MC3T3-E1 cells after HOXA7 knockdown. (A) Western blotting of p-JNK/JNK and p-p38/p38 in MC3T3-E1 cells under the indicated conditions. (B) CCK-8 assay assessing cell viability. (C) Flow cytometry analysis of apoptosis. (D) Western blotting of ATG12, p62, and LC3-II/I. Significance vs. si-NC: **P < 0.01, ***P < 0.001, ****P < 0.0001. Significance vs. si-HOXA7: ##P < 0.01, ###P < 0.001, ####P < 0.0001.

Journal: Journal of Musculoskeletal & Neuronal Interactions

Article Title: HOXA7 Impairs Osteogenic Differentiation via p38/JNK Signaling: Implications for Osteoporosis

doi: 10.22540/JMNI-26-134

Figure Lengend Snippet: Effects of SP600125 and SB203580 on proliferation, apoptosis, and autophagy in MC3T3-E1 cells after HOXA7 knockdown. (A) Western blotting of p-JNK/JNK and p-p38/p38 in MC3T3-E1 cells under the indicated conditions. (B) CCK-8 assay assessing cell viability. (C) Flow cytometry analysis of apoptosis. (D) Western blotting of ATG12, p62, and LC3-II/I. Significance vs. si-NC: **P < 0.01, ***P < 0.001, ****P < 0.0001. Significance vs. si-HOXA7: ##P < 0.01, ###P < 0.001, ####P < 0.0001.

Article Snippet: p-p38 , 9216 , 1:1,000 , CST, Danvers, MA, USA.

Techniques: Knockdown, Western Blot, CCK-8 Assay, Flow Cytometry

Silencing Rac1 inhibits the activation of P38 MAPK signal in vitro . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) were detected by Western blot analysis. GAPDH served as the internal reference. All experiments were repeated 3 times and the results are presented as mean ±SD. *** P<0.001 compared with the negative control group.

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

Article Title: Silencing Ras-Related C3 Botulinum Toxin Substrate 1 Inhibits Growth and Migration of Hypopharyngeal Squamous Cell Carcinoma via the P38 Mitogen-Activated Protein Kinase Signaling Pathway

doi: 10.12659/MSM.907468

Figure Lengend Snippet: Silencing Rac1 inhibits the activation of P38 MAPK signal in vitro . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) were detected by Western blot analysis. GAPDH served as the internal reference. All experiments were repeated 3 times and the results are presented as mean ±SD. *** P<0.001 compared with the negative control group.

Article Snippet: The membranes were blocked with 5% skim milk or 1% bovine serum albumin, and then incubated with Rac1 antibody, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (1: 1000; Proteintech, Wuhan, China), Cyclin D1 antibody (1: 1000; BOSTER, Wuhan, China), Cyclin E antibody, Cyclin B antibody (1: 500; Bioss, Beijing, China), metal matrix proteinase (MMP)-2 antibody, MMP-9 antibody, B cell lymphoma-2 (Bcl-2) antibody, Bcl-2-associated X protein (Bax) antibody, phosphorylated-MAP kinase (p-MKK3) antibody (1: 500; Sangon Biotech, Shanghai, China), caspase-3 antibody, caspase-9 antibody, poly ADP-ribose polymerase (PARP) antibody (1: 1000; Cell Signaling Technology, Beverly, MA, USA), p38 mitogen-activated protein kinase (MAPK) antibody, p-p38 MAPK antibody (1: 500; KeyGen, Nanjing, China), or MKK3 antibody (1: 300; BOSTER) overnight at 4°C.

Techniques: Activation Assay, In Vitro, Western Blot, Negative Control

Rac1 silencing inhibits the activation of P38 MAPK signal in vivo . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) in each group were detected by Western blot analysis with GAPDH as the internal reference. All experiments were repeated 3 times. The results are presented as mean ±SD. N=6. *** P<0.001 compared with the negative control group.

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

Article Title: Silencing Ras-Related C3 Botulinum Toxin Substrate 1 Inhibits Growth and Migration of Hypopharyngeal Squamous Cell Carcinoma via the P38 Mitogen-Activated Protein Kinase Signaling Pathway

doi: 10.12659/MSM.907468

Figure Lengend Snippet: Rac1 silencing inhibits the activation of P38 MAPK signal in vivo . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) in each group were detected by Western blot analysis with GAPDH as the internal reference. All experiments were repeated 3 times. The results are presented as mean ±SD. N=6. *** P<0.001 compared with the negative control group.

Article Snippet: The membranes were blocked with 5% skim milk or 1% bovine serum albumin, and then incubated with Rac1 antibody, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (1: 1000; Proteintech, Wuhan, China), Cyclin D1 antibody (1: 1000; BOSTER, Wuhan, China), Cyclin E antibody, Cyclin B antibody (1: 500; Bioss, Beijing, China), metal matrix proteinase (MMP)-2 antibody, MMP-9 antibody, B cell lymphoma-2 (Bcl-2) antibody, Bcl-2-associated X protein (Bax) antibody, phosphorylated-MAP kinase (p-MKK3) antibody (1: 500; Sangon Biotech, Shanghai, China), caspase-3 antibody, caspase-9 antibody, poly ADP-ribose polymerase (PARP) antibody (1: 1000; Cell Signaling Technology, Beverly, MA, USA), p38 mitogen-activated protein kinase (MAPK) antibody, p-p38 MAPK antibody (1: 500; KeyGen, Nanjing, China), or MKK3 antibody (1: 300; BOSTER) overnight at 4°C.

Techniques: Activation Assay, In Vivo, Western Blot, Negative Control

FIGURE 3. FBS induces the phosphorylation of JNK, p38, and ERK in CHO-K1cells.Serum-starvedCHO-K1cellsweretreatedwith7.5%FBSforthe indicated times. Total and phosphorylated JNK, p38, and ERK were monitored by Western blot.

Journal: Journal of Biological Chemistry

Article Title: JNK and Ceramide Kinase Govern the Biogenesis of Lipid Droplets through Activation of Group IVA Phospholipase A2

doi: 10.1074/jbc.m109.061515

Figure Lengend Snippet: FIGURE 3. FBS induces the phosphorylation of JNK, p38, and ERK in CHO-K1cells.Serum-starvedCHO-K1cellsweretreatedwith7.5%FBSforthe indicated times. Total and phosphorylated JNK, p38, and ERK were monitored by Western blot.

Article Snippet: Rabbit anti-cPLA2 , anti-phospho-Ser-505-cPLA2 , anti-JNK, anti-phospho-Thr-183/Tyr-185-JNK, anti-p38, antiphospho-Thr-180/Tyr-182-p38, anti-p44/42, and anti-phosphoThr-202/Tyr-204-p44/p42 antibodies were from Cell Signaling; chicken anti-ADRP was from GenWay Biotech; rabbit anti-glyceraldehyde-3-phosphate dehydrogenase was from Ambion, and rabbit anti-CERK fromAbcam.

Techniques: Phospho-proteomics, Western Blot

FIGURE 6. 4MU exerts no effect on initial TGF-induced signaling. A, light emission by 3TP-LUX, a luciferase reporter plasmid driven by TGF-respon- sive promoter, after 24 h TGF treatment stimulated light emission by 15- fold in primary keratocytes (p 0.001). This reporter activity was not dimin- ished by treatment with 500 M 4MU. 3TP-Lux activity was normalized by co-transfectionwithcontrolplasmidasdescribedunder“MaterialsandMeth- ods.” The error bars show S.D. of quadruplicate analyses. The difference between TGF and TGF4MU was not significant. B, duplicate cultures of primary keratocytes were treated for 1 h with TGF (as in Fig. 2) in the pres- ence or absence of 400 M 4MU. Equal amounts of protein from cell lysates were immunoblotted for phosphorylated p38 MAPK (pp38) using the non- phosphorylated p38 as a loading control. Coum, coumarin; 4ME, 4-methyles- culetin; ESC, esculetin; CTRL, control.

Journal: Journal of Biological Chemistry

Article Title: Hyaluronan Synthesis Mediates the Fibrotic Response of Keratocytes to Transforming Growth Factor β

doi: 10.1074/jbc.m110.127183

Figure Lengend Snippet: FIGURE 6. 4MU exerts no effect on initial TGF-induced signaling. A, light emission by 3TP-LUX, a luciferase reporter plasmid driven by TGF-respon- sive promoter, after 24 h TGF treatment stimulated light emission by 15- fold in primary keratocytes (p 0.001). This reporter activity was not dimin- ished by treatment with 500 M 4MU. 3TP-Lux activity was normalized by co-transfectionwithcontrolplasmidasdescribedunder“MaterialsandMeth- ods.” The error bars show S.D. of quadruplicate analyses. The difference between TGF and TGF4MU was not significant. B, duplicate cultures of primary keratocytes were treated for 1 h with TGF (as in Fig. 2) in the pres- ence or absence of 400 M 4MU. Equal amounts of protein from cell lysates were immunoblotted for phosphorylated p38 MAPK (pp38) using the non- phosphorylated p38 as a loading control. Coum, coumarin; 4ME, 4-methyles- culetin; ESC, esculetin; CTRL, control.

Article Snippet: EDA-FN and SMA were detected by immunoblottingwithmonoclonal antibody against EDA-FN (Axyll) or monoclonal antibody against S (clone asm-1; Sigma-Aldrich). p38 MAPK was detected using Cell Signaling Technologies antibody L53F8 and phospho-p38 MAPK with 4631S.

Techniques: Luciferase, Plasmid Preparation, Activity Assay, Control

KEGG MAPK signaling pathway enrichment plot. (A-a) The top 20 pathways are highly concentrated in core processes such as tumor-related signal transduction, cell proliferation and apoptosis regulation, metabolism, and inflammation/immunity. These include EGFR tyrosine kinase inhibitor resistance, HIF-1, VEGF, IL-17, TNF, JAK-STAT, PI3K-Akt, MAPK, mTOR, AMPK, FoxO, p53, as well as cell cycle, PD-1/PD-L1 immune checkpoint pathways, B-cell receptor signaling, autophagy-autophagy, NOD-like receptor signaling, lipid and atherosclerosis, serotonergic synapse, and Salmonella infection pathways. Pathways with higher fold enrichment and larger bubbles (e.g., PI3K-Akt, MAPK, TNF, HIF-1, p53, Cell Cycle, Autophagy, etc.) indicate a higher concentration of overlapping genes within these pathways and a significantly increased enrichment factor. This suggests that curcumin’s targets in osteosarcoma primarily cluster within key signaling networks regulating cell proliferation/apoptosis, autophagy, energy metabolism reprogramming, inflammation, and the immune microenvironment. (A-b) Mapping results reveal that the intersecting target genes are widely distributed across the MAPK signaling pathway, covering the classical MAPK cascade, JNK/p38 branches, and key nodes interacting with the p53 pathway (Figure X). Upstream, molecules such as TNF and other cytokines are highlighted, suggesting that inflammation and stress stimuli are important triggers for activating this pathway. Midstream, multi-tiered kinase cascades (e.g., MAPKKK–MAPKK–MAPK) and stress-responsive MAPK members like JNK and p38 were marked, indicating that intersecting targets primarily participate in amplifying and transducing stress signals. Downstream, transcription factor nodes such as TP53 were also enriched, connecting to effector pathways including cell cycle arrest, apoptosis, and differentiation.

Journal: Open Life Sciences

Article Title: Curcumin induces apoptosis in osteosarcoma cells by regulating the glycolytic pathway via the MAPK axis: a mechanistic study

doi: 10.1515/biol-2025-1296

Figure Lengend Snippet: KEGG MAPK signaling pathway enrichment plot. (A-a) The top 20 pathways are highly concentrated in core processes such as tumor-related signal transduction, cell proliferation and apoptosis regulation, metabolism, and inflammation/immunity. These include EGFR tyrosine kinase inhibitor resistance, HIF-1, VEGF, IL-17, TNF, JAK-STAT, PI3K-Akt, MAPK, mTOR, AMPK, FoxO, p53, as well as cell cycle, PD-1/PD-L1 immune checkpoint pathways, B-cell receptor signaling, autophagy-autophagy, NOD-like receptor signaling, lipid and atherosclerosis, serotonergic synapse, and Salmonella infection pathways. Pathways with higher fold enrichment and larger bubbles (e.g., PI3K-Akt, MAPK, TNF, HIF-1, p53, Cell Cycle, Autophagy, etc.) indicate a higher concentration of overlapping genes within these pathways and a significantly increased enrichment factor. This suggests that curcumin’s targets in osteosarcoma primarily cluster within key signaling networks regulating cell proliferation/apoptosis, autophagy, energy metabolism reprogramming, inflammation, and the immune microenvironment. (A-b) Mapping results reveal that the intersecting target genes are widely distributed across the MAPK signaling pathway, covering the classical MAPK cascade, JNK/p38 branches, and key nodes interacting with the p53 pathway (Figure X). Upstream, molecules such as TNF and other cytokines are highlighted, suggesting that inflammation and stress stimuli are important triggers for activating this pathway. Midstream, multi-tiered kinase cascades (e.g., MAPKKK–MAPKK–MAPK) and stress-responsive MAPK members like JNK and p38 were marked, indicating that intersecting targets primarily participate in amplifying and transducing stress signals. Downstream, transcription factor nodes such as TP53 were also enriched, connecting to effector pathways including cell cycle arrest, apoptosis, and differentiation.

Article Snippet: Osteosarcoma U2OS and MG63 cells were purchased from Sigma; U2OS and MG63-specific culture media were purchased from Sevier Bio; Curcumin was purchased from Aladdin (H136625); CCK-8 assay kit (C0038) was purchased from Biyun Tian; Annexin V-FITC staining solution was purchased from Biyun Tian (C1062S); HRP-conjugated goat anti-rabbit secondary antibody purchased from Sevier Bio (GB23303); ECL chemiluminescent reagent (G2020) purchased from Sevier Bio; Protein BCA quantification kit purchased from Biyun Tian Biotechnology (P0010); BD vertical electrophoresis apparatus and flow cytometer purchased from Shanghai Lingcheng Biotechnology Co., Ltd.; Protein-Free Rapid Blocking Solution (G2052-500 ML) and TUNEL Apoptosis Detection Kit (G1501-50T) purchased from Sevier Bio; Bax ( R22708 ), Bcl-2 ( R23309 ), Cleaved-Parp ( R09874 ), HK2 ( P29803 ), PDHA ( P29803 ), P-JNK (P5983), P-P38 ( Q16539 ), PKM2 ( P14618 ), GLUT1 ( P11166 ) antibodies were purchased from Zhengneng Bio; GAPDH monoclonal antibody (SC47724) was purchased from Santa Cruz Biotechnology, USA; purchased from ZEN bio; P38 (14064-1-AP) and JNK (66210-1-lg) were purchased from ProteinTech Group.

Techniques: Transduction, Infection, Concentration Assay

Effects of different curcumin concentrations on JNK/P38 signaling pathway protein expression in U2OS and MG63 cells. Curcumin activates the JNK/p38 MAPK signaling pathway in osteosarcoma cells. Representative western blots and quantitative densitometry of phosphorylated JNK (p-JNK), total JNK, phosphorylated p38 (p-p38), and total p38 in U2OS and MG63 cells treated with curcumin (0, 20, and 40 μM) for 24 h. Total JNK and total p38 levels showed no significant changes among groups, whereas p-JNK and p-p38 levels increased in a dose-dependent manner. Phosphorylation was quantified as p-JNK/JNK and p-p38/p38, and then normalized to the loading control (GAPDH). Data are presented as mean ± SD ( n = 3). (A)Effects of curcumin on JNK/P38 signaling pathway protein expression in U2OS and MG63 cells ( x ± s , n = 3). * P < 0.05 versus control group. (A-a) U2OS cells: Expression levels of P-JNK/JNK, P38, and P-P38/P38. * P < 0.05,** P < 0.01 and *** P < 0.001 versus control group. (A-b) MG63 cells: Expression levels of P-JNK/JNK, and P-P38/P38. * P < 0.05,*** P < 0.001 versus control group.

Journal: Open Life Sciences

Article Title: Curcumin induces apoptosis in osteosarcoma cells by regulating the glycolytic pathway via the MAPK axis: a mechanistic study

doi: 10.1515/biol-2025-1296

Figure Lengend Snippet: Effects of different curcumin concentrations on JNK/P38 signaling pathway protein expression in U2OS and MG63 cells. Curcumin activates the JNK/p38 MAPK signaling pathway in osteosarcoma cells. Representative western blots and quantitative densitometry of phosphorylated JNK (p-JNK), total JNK, phosphorylated p38 (p-p38), and total p38 in U2OS and MG63 cells treated with curcumin (0, 20, and 40 μM) for 24 h. Total JNK and total p38 levels showed no significant changes among groups, whereas p-JNK and p-p38 levels increased in a dose-dependent manner. Phosphorylation was quantified as p-JNK/JNK and p-p38/p38, and then normalized to the loading control (GAPDH). Data are presented as mean ± SD ( n = 3). (A)Effects of curcumin on JNK/P38 signaling pathway protein expression in U2OS and MG63 cells ( x ± s , n = 3). * P < 0.05 versus control group. (A-a) U2OS cells: Expression levels of P-JNK/JNK, P38, and P-P38/P38. * P < 0.05,** P < 0.01 and *** P < 0.001 versus control group. (A-b) MG63 cells: Expression levels of P-JNK/JNK, and P-P38/P38. * P < 0.05,*** P < 0.001 versus control group.

Article Snippet: Osteosarcoma U2OS and MG63 cells were purchased from Sigma; U2OS and MG63-specific culture media were purchased from Sevier Bio; Curcumin was purchased from Aladdin (H136625); CCK-8 assay kit (C0038) was purchased from Biyun Tian; Annexin V-FITC staining solution was purchased from Biyun Tian (C1062S); HRP-conjugated goat anti-rabbit secondary antibody purchased from Sevier Bio (GB23303); ECL chemiluminescent reagent (G2020) purchased from Sevier Bio; Protein BCA quantification kit purchased from Biyun Tian Biotechnology (P0010); BD vertical electrophoresis apparatus and flow cytometer purchased from Shanghai Lingcheng Biotechnology Co., Ltd.; Protein-Free Rapid Blocking Solution (G2052-500 ML) and TUNEL Apoptosis Detection Kit (G1501-50T) purchased from Sevier Bio; Bax ( R22708 ), Bcl-2 ( R23309 ), Cleaved-Parp ( R09874 ), HK2 ( P29803 ), PDHA ( P29803 ), P-JNK (P5983), P-P38 ( Q16539 ), PKM2 ( P14618 ), GLUT1 ( P11166 ) antibodies were purchased from Zhengneng Bio; GAPDH monoclonal antibody (SC47724) was purchased from Santa Cruz Biotechnology, USA; purchased from ZEN bio; P38 (14064-1-AP) and JNK (66210-1-lg) were purchased from ProteinTech Group.

Techniques: Expressing, Western Blot, Phospho-proteomics, Control

A mechanism model: “curcumin-JNK/P38 MAPK-glycolysis-mitochondrial apoptosis.

Journal: Open Life Sciences

Article Title: Curcumin induces apoptosis in osteosarcoma cells by regulating the glycolytic pathway via the MAPK axis: a mechanistic study

doi: 10.1515/biol-2025-1296

Figure Lengend Snippet: A mechanism model: “curcumin-JNK/P38 MAPK-glycolysis-mitochondrial apoptosis.

Article Snippet: Osteosarcoma U2OS and MG63 cells were purchased from Sigma; U2OS and MG63-specific culture media were purchased from Sevier Bio; Curcumin was purchased from Aladdin (H136625); CCK-8 assay kit (C0038) was purchased from Biyun Tian; Annexin V-FITC staining solution was purchased from Biyun Tian (C1062S); HRP-conjugated goat anti-rabbit secondary antibody purchased from Sevier Bio (GB23303); ECL chemiluminescent reagent (G2020) purchased from Sevier Bio; Protein BCA quantification kit purchased from Biyun Tian Biotechnology (P0010); BD vertical electrophoresis apparatus and flow cytometer purchased from Shanghai Lingcheng Biotechnology Co., Ltd.; Protein-Free Rapid Blocking Solution (G2052-500 ML) and TUNEL Apoptosis Detection Kit (G1501-50T) purchased from Sevier Bio; Bax ( R22708 ), Bcl-2 ( R23309 ), Cleaved-Parp ( R09874 ), HK2 ( P29803 ), PDHA ( P29803 ), P-JNK (P5983), P-P38 ( Q16539 ), PKM2 ( P14618 ), GLUT1 ( P11166 ) antibodies were purchased from Zhengneng Bio; GAPDH monoclonal antibody (SC47724) was purchased from Santa Cruz Biotechnology, USA; purchased from ZEN bio; P38 (14064-1-AP) and JNK (66210-1-lg) were purchased from ProteinTech Group.

Techniques: